
Type your tag names separated by a space and hit enter

Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.
Hereditas. 2004; 141(3):193-8.H


Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.

Authors+Show Affiliations

College of Life Sciences, Northwest Sci-Tech University of Agriculture and Forestry, Yangling, Shaanxi, PR China. huixianzhao212@hotmail.comNo affiliation info availableNo affiliation info availableNo affiliation info availableNo affiliation info available

Pub Type(s)

Journal Article
Research Support, Non-U.S. Gov't



PubMed ID



Zhao, Huixian, et al. "Development of Primers Specific for LMW-GS Genes Located On Chromosome 1D and Molecular Characterization of a Gene From Glu-D3 Complex Locus in Bread Wheat." Hereditas, vol. 141, no. 3, 2004, pp. 193-8.
Zhao H, Wang R, Guo A, et al. Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat. Hereditas. 2004;141(3):193-8.
Zhao, H., Wang, R., Guo, A., Hu, S., & Sun, G. (2004). Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat. Hereditas, 141(3), 193-8.
Zhao H, et al. Development of Primers Specific for LMW-GS Genes Located On Chromosome 1D and Molecular Characterization of a Gene From Glu-D3 Complex Locus in Bread Wheat. Hereditas. 2004;141(3):193-8. PubMed PMID: 15703035.
* Article titles in AMA citation format should be in sentence-case
TY - JOUR T1 - Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat. AU - Zhao,Huixian, AU - Wang,Ruijuan, AU - Guo,Aiguang, AU - Hu,Shengwu, AU - Sun,Genlou, PY - 2005/2/11/pubmed PY - 2006/7/1/medline PY - 2005/2/11/entrez SP - 193 EP - 8 JF - Hereditas JO - Hereditas VL - 141 IS - 3 N2 - Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far. SN - 0018-0661 UR - https://www.unboundmedicine.com/medline/citation/15703035/Development_of_primers_specific_for_LMW_GS_genes_located_on_chromosome_1D_and_molecular_characterization_of_a_gene_from_Glu_D3_complex_locus_in_bread_wheat_ DB - PRIME DP - Unbound Medicine ER -