Tags

Type your tag names separated by a space and hit enter

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].
Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2005 Aug; 13(4):542-7.ZS

Abstract

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

Authors+Show Affiliations

Institute of Transfusion Medicine, Academy of Military Medical Sciences, Beijing 100850, China.No affiliation info availableNo affiliation info availableNo affiliation info availableNo affiliation info availableNo affiliation info availableNo affiliation info availableNo affiliation info available

Pub Type(s)

English Abstract
Journal Article
Research Support, Non-U.S. Gov't

Language

chi

PubMed ID

16129030

Citation

Zhang, Yan-Yu, et al. "[Cloning and Bioinformatics Analysis of a Thrombin-like Enzyme Gene From Agkistrodon Acutus]." Zhongguo Shi Yan Xue Ye Xue Za Zhi, vol. 13, no. 4, 2005, pp. 542-7.
Zhang YY, Ma P, Lu YM, et al. [Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus]. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2005;13(4):542-7.
Zhang, Y. Y., Ma, P., Lu, Y. M., Lü, L. P., Jiang, S. Y., Zhou, X. P., Sun, S. H., & Xu, J. B. (2005). [Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus]. Zhongguo Shi Yan Xue Ye Xue Za Zhi, 13(4), 542-7.
Zhang YY, et al. [Cloning and Bioinformatics Analysis of a Thrombin-like Enzyme Gene From Agkistrodon Acutus]. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 2005;13(4):542-7. PubMed PMID: 16129030.
* Article titles in AMA citation format should be in sentence-case
TY - JOUR T1 - [Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus]. AU - Zhang,Yan-Yu, AU - Ma,Ping, AU - Lu,Yi-Ming, AU - Lü,Li-Ping, AU - Jiang,Sheng-Yang, AU - Zhou,Xi-Peng, AU - Sun,Shu-Han, AU - Xu,Jin-Bo, PY - 2005/9/1/pubmed PY - 2008/9/6/medline PY - 2005/9/1/entrez SP - 542 EP - 7 JF - Zhongguo shi yan xue ye xue za zhi JO - Zhongguo Shi Yan Xue Ye Xue Za Zhi VL - 13 IS - 4 N2 - The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion. SN - 1009-2137 UR - https://www.unboundmedicine.com/medline/citation/16129030/[Cloning_and_bioinformatics_analysis_of_a_thrombin_like_enzyme_gene_from_Agkistrodon_acutus]_ L2 - https://www.lens.org/lens/search?q=citation_id:16129030 DB - PRIME DP - Unbound Medicine ER -